View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15974_low_22 (Length: 234)
Name: NF15974_low_22
Description: NF15974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15974_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 3426333 - 3426133
Alignment:
| Q |
19 |
ggtcgaaccactgttctcgtggctcatcgtttgtcaacaattcgaggagttgattgcattggtgtcgtgcaagacggtcgcattgtcgaacaaggaagcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426333 |
ggtcgaaccactgttctcgtggctcatcgtttgtcaacaattcgaggagttgattgcattggtgtcgtgcaagacggtcgcattgtcgaacaaggaagcc |
3426234 |
T |
 |
| Q |
119 |
attctgaactcattagcaggccagaaggagcttattctagactcttgcagctacaacatcatcacatttgagatttttatttgataaaatatgatcatga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426233 |
attctgaactcattagcaggccagaaggagcttattctagactcttgcagctacaacatcatcacatttgagatttttatttgataaaatatgatcatga |
3426134 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
3426133 |
t |
3426133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University