View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15974_low_23 (Length: 218)
Name: NF15974_low_23
Description: NF15974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15974_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 156
Target Start/End: Complemental strand, 39325482 - 39325345
Alignment:
| Q |
19 |
agaggttgcagtaaaacttggggatttgaaatgttgaatttgtaacgagctttggaaacctagtcacttaattggaaaatggcactccaattaacctggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39325482 |
agaggttgcagtaaaacttggggatttgaaatgttgaatttgtaacgagctttggaaacctagtcacttaattggaaaatggcacttcaattaacctggc |
39325383 |
T |
 |
| Q |
119 |
aaacaggcgtactgtatgagaatgacaaataacactca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39325382 |
aaacaggcgtactgtatgagaatgacaaataacactca |
39325345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University