View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15974_low_24 (Length: 218)
Name: NF15974_low_24
Description: NF15974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15974_low_24 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 3426064 - 3425861
Alignment:
| Q |
15 |
agatgtagatatgtgttctttatgaggtttgtaccttaaggacaaaagtgctctattttcaatagagtatcaagtattatatattattaatcatatttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3426064 |
agatgtagatatgtgttctttatgaggtttgtaccttaaggacaaaagtgctctattttcaatagagtatcaagtattatatattattaatcatatttca |
3425965 |
T |
 |
| Q |
115 |
aaggtgcacaagcatgttatctatctgtttttgttttagcttttcttgtactttactattaatataattcagtgccaacaattgcatgttgtattgccct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3425964 |
aaggtgcacaagcatgttatctatctgtttttgttttagcttttcttgtactttactattaatataattcagttccaacaattgcatgttgtattgccct |
3425865 |
T |
 |
| Q |
215 |
ttgc |
218 |
Q |
| |
|
|||| |
|
|
| T |
3425864 |
ttgc |
3425861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University