View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_high_19 (Length: 343)
Name: NF15976_high_19
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 3 - 324
Target Start/End: Original strand, 30729244 - 30729564
Alignment:
| Q |
3 |
atcatatttcattgaggaaggttattgtgggacatattttggtgaatttaccgtgggacatatatacgattgtttttctgagggaacatatttatgattg |
102 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30729244 |
atcatatttcattaaggaaggttattgtgggacatattttggtgaatttaccgtgggacatatatatgattgtttttctgagggaacatatttatgattg |
30729343 |
T |
|
| Q |
103 |
ttgtcttccatatgtatatcattcatctacttttatgctgaccaacaaaacaacaacatgaaaaattcagttttggccgtgcttctcgtgttatcttcac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30729344 |
ttgtcttccatatgtatatcattcatctacttttatgctgaccaacaaaacaacaacatgaaaaattcagttttggccctgcttctcgtgttatcttcac |
30729443 |
T |
|
| Q |
203 |
cattgaaatttaaaatcaatatgcaagttgtagggcaaagatgggtgttaccnnnnnnnnctgcactattttcacttccaatataatataaaggtgtttg |
302 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30729444 |
cattgaaatttaaaatcaatatacaagttgtagggcaaagatgggtgttacc-aaaaaaactgcactattttcacttccaatataatataaaggagtttg |
30729542 |
T |
|
| Q |
303 |
ttgctctagttggtgtgccact |
324 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30729543 |
ttgctctagttggtgtgccact |
30729564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 95 - 162
Target Start/End: Complemental strand, 7733058 - 7732991
Alignment:
| Q |
95 |
tatgattgttgtcttccatatgtatatcattcatctacttttatgctgaccaacaaaacaacaacatg |
162 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7733058 |
tatgattgttgtcttctatatgcatgtcattcatctacttttatgctgaccaacaaaacagcaacatg |
7732991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University