View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_high_24 (Length: 319)
Name: NF15976_high_24
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 301
Target Start/End: Complemental strand, 26126421 - 26126139
Alignment:
| Q |
19 |
atttattgccagttttccatggggtaccgctaagttccctcatccagtcatctcagtaaaaagattttatatttttaggttagaagaaagatttggagta |
118 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126421 |
atttattgccagttttccacggggtgccgctaagttccctcatccagtcatcccagtaaaaagattttatatttttaggttagaagaaagatttggagta |
26126322 |
T |
 |
| Q |
119 |
ggaaatatattgttggaatcacataaatgatgttgttcaaaagacgaaggtgtaagaaatagttcacatgttttggtcgggaggaaagatatgatgctac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
26126321 |
ggaaatatattgttggaatcacataaatgatgtagttcaaaagacgaaggcgtaagaaatagttcacgtgttttggtcgggaggaaagataggatgctac |
26126222 |
T |
 |
| Q |
219 |
aaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgatgagctatgt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26126221 |
aaaacactctatcggactttgtgccttacgacattctatctttactactgatcaaaacatgtgtaggctacgatgagctatgt |
26126139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University