View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_high_33 (Length: 231)
Name: NF15976_high_33
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 8e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 69 - 221
Target Start/End: Complemental strand, 7709149 - 7708997
Alignment:
| Q |
69 |
tattttgggaaaaaaggaatgaaggagtgttacatagtggttaaccaaatcctcatatattatcatatctttaatatcttttttctttcttaggtgctca |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7709149 |
tattttgggaaaaaaggaatgaaggagtgttacatagtggttaaccaaatcctcatatattatcatatctttaatatcttttttctttcttaggtgctca |
7709050 |
T |
 |
| Q |
169 |
ctttgggtttaaagcaaagcaagtgtgatgtttatggtgacttgttgtgatga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7709049 |
ttttgggtttaaagcaaagcaagtgtgatgtttatggtgacttgttgtgatga |
7708997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 138 - 219
Target Start/End: Complemental strand, 7711246 - 7711165
Alignment:
| Q |
138 |
tttaatatcttttttctttcttaggtgctcactttgggtttaaagcaaagcaagt-gtgatgtttatggtgacttgttgtgat |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7711246 |
tttaatctcttttttctttcttaggtgctcatcttgggcttaaaacaaagcaagtactga-gtttatggtgacttgttgtgat |
7711165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 7709203 - 7709168
Alignment:
| Q |
17 |
aacttttagaattgagaccttaaataatactaagat |
52 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7709203 |
aacttttagaattgaggccttaaataatactaagat |
7709168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University