View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_11 (Length: 471)
Name: NF15976_low_11
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 301
Target Start/End: Original strand, 27512741 - 27513033
Alignment:
| Q |
17 |
taatcttcgaaaa-ttagagataaatctatcccacttctactaa-----taaaccaaccccaagagacta--tcttaatcttcaaaaactatgttgttac |
108 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| |||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27512741 |
taatcttcgaaaaattagagataaatctttcccatttctaccaataaattaaaccaaccccaagagactatctcttaatcttcaaaaactatgttgttac |
27512840 |
T |
 |
| Q |
109 |
aatgaagccatgatacgccaaaccactgctaaccatgcatattatatactttactctagtgcatgcacttcttcaccttcaatccctcaccaaactaaat |
208 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27512841 |
aatgaagccatgatacaccaaaccacagctaaccatgcatattatatactttactctagtgcatgcacatcttcaccttcaatccctcaccaaactaaat |
27512940 |
T |
 |
| Q |
209 |
aaaatgttgaattggctgattgattaatgcatcttcacctttgtactcatccattgagttatcacatcccaaaggttaatgaatgtgctagga |
301 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27512941 |
aaaatgttgaattgcctgattgattaatgcatcttcacctttgtactcatccattgagttatcacatcccaaaggttaatgaatttgctagga |
27513033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 339 - 458
Target Start/End: Original strand, 27513030 - 27513149
Alignment:
| Q |
339 |
aggagggatagttgcttactactctggataagttggtttctggattgaagattcattttactagaaataacgtcattggtctgaatttggagaaagattc |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27513030 |
aggagggatagttgcttactactctggataagttggtttctggattgaagattcattttactagaaataacgtcattggtctgaatttggagaaagattc |
27513129 |
T |
 |
| Q |
439 |
ataacgactattcccagttc |
458 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27513130 |
ataacgactattcccagttc |
27513149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University