View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_17 (Length: 406)
Name: NF15976_low_17
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 19 - 372
Target Start/End: Original strand, 10821713 - 10822065
Alignment:
| Q |
19 |
agtgaagttgatttgggatttggaagtccattgttggggacagtgtatacctcaattgaaaaggttggtgttggttatatgaatcaaaggcaaagtggta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10821713 |
agtgaagttgatttgggatttggaagtccattgttagggacagtgtatacctcaattgaaagggttggtgttggttatatgaatcaaaggcaaagtggca |
10821812 |
T |
|
| Q |
119 |
agggtgatggttcatggactgtttcagctatattgtggcctgaattagtagatgctttgaaggatgatccaatttttcagcccatgactgcttctcatct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10821813 |
agggtgatggttcatggactgtttcagctatattgtggcctgaattagtagatgctttgaaggatgatccaatttttcagcccatgactgcttcttatct |
10821912 |
T |
|
| Q |
219 |
acagctttagtacaatgcattcgtagcatcaacacttcgaatcgaatgtgtgtccgatacatgtctttacattcaattattacgtattctcaagttattg |
318 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10821913 |
acagctttagtacaatgcatatgtagcatcaacacttcgaattgaaggtgtgtccgatacatgtgtttacattcaattattacgtattctcaagttattg |
10822012 |
T |
|
| Q |
319 |
caagttgttgttgttaacgtgttagtgtcgtgttcagtacttgtggctgtatca |
372 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
10822013 |
caag-tgttgttattaacgtgtcagtgtcgtgttctatacttgtggctgtatca |
10822065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University