View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_24 (Length: 342)
Name: NF15976_low_24
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 18 - 335
Target Start/End: Complemental strand, 41735242 - 41734922
Alignment:
| Q |
18 |
taaacaatgtaacaacaatagttcaatatatttaaatgaccgatttacaatggttctcgacatcaatttaattgcgaaaatgtcttttatcttgtaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735242 |
taaacaatgtaacaacaatagttcaatatatttaaatgaccgatttacaatggttctcgacatcaatttaattgcgaaaatgtcttttatcttgtaattc |
41735143 |
T |
 |
| Q |
118 |
ccatttttcactagtgatgggcgatagtcatatattcttcacaccaattcaatatatagttggccta---atcagattggtaatctaccatatgccaacc |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41735142 |
ccattttgcactagtgatgggcgatagtcatatattcttcacaccaattcaatatatagttggcctaatgatcagattggtaatctaccatatgccaacc |
41735043 |
T |
 |
| Q |
215 |
ttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgccactgatcataatatgatgaagcaaaatctattagtgaaaata |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735042 |
ttggtagagtatttatacacttttaccatccatcttgacatcaccaattcaatctgccactgatcataatatgatgaagcaaaatctattagtgaaaata |
41734943 |
T |
 |
| Q |
315 |
atcactcttctccctttgctt |
335 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
41734942 |
atcactcttctcccttggctt |
41734922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University