View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_26 (Length: 322)
Name: NF15976_low_26
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 236
Target Start/End: Original strand, 45314011 - 45314226
Alignment:
| Q |
21 |
ttagaatattcattagtggaaagtgatcattcctcg-ctctaagactcttcaaggttagacatctaagtataaccgtgaattttcattgtctatcgtcat |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45314011 |
ttagaatattcattggtggaaagtgatcattcctcggctctaagactcttcaaggttagacatctaagtataaccgtgaattttcattgtctatc-tcat |
45314109 |
T |
|
| Q |
120 |
tttatctatttactaaataaaatgtaaagcttttatatagtcaaacaatcacaacaaattgtaaatccaacttttatgatgattttaattcaaaccaaac |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45314110 |
tttatctatttactgaataaaatgtaaagcttttatatagtcaaacaatcacaacaaattgtaaatccaacttttatgatgattttaatttaaaccaaac |
45314209 |
T |
|
| Q |
220 |
atttctattgatccaac |
236 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
45314210 |
atttctattgacccaac |
45314226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University