View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_40 (Length: 226)
Name: NF15976_low_40
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 41242281 - 41242082
Alignment:
| Q |
13 |
caaaggtggtggttaaaccgtttaacacgtttgggccaacttcgaaggaagattgccaatgctaataacatcatgacagctaaaaataatgnnnnnnn-c |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41242281 |
caaaggtggtggttaaaccgtttaacacgtttgggccaacttcgaaggaagattgccaatgctaataacatcatgacagctaaaaataatgttttttttc |
41242182 |
T |
 |
| Q |
112 |
ttcttaaagaaggtaggaataatgttaaatttgaatttcgttgtgtttgatgtggaaatagtgtaatctttttattttacggaaaatagtctaacattat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41242181 |
ttcttaaagaaggtaggaataatgttaaatttgaatttcgttgtgtttgatgtggaaatagtgtaatctttttattttacggaaaatagtctaacattat |
41242082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University