View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_41 (Length: 201)
Name: NF15976_low_41
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 28054866 - 28054724
Alignment:
| Q |
1 |
tattccattccatgatcctctcaaccagcaaattgcattgctttccttctccataaaatattactaccatactcacgttttacatttactcaaccaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
28054866 |
tattccattccatgatcctctcaactagcaaattgcattgctttccttctccataaaatattactaacatactcacattttacatttactcaaccaacca |
28054767 |
T |
|
| Q |
101 |
tataccaccttagcttgcaccagtttttagacacaagactcag |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054766 |
tataccaccttagcttgcaccagtttttagacacaagactcag |
28054724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University