View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15976_low_7 (Length: 529)
Name: NF15976_low_7
Description: NF15976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15976_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 1e-82; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 189 - 344
Target Start/End: Original strand, 40376025 - 40376180
Alignment:
| Q |
189 |
cttgtgatgagggtggctccgatggccggacggtggtggtgggagtgaaaatggattcaccaagcaaagagcttcttacttgggctttggttaaagttgc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376025 |
cttgtgatgagggtggctccgatggccggacggtggtggtgggagtgaaaatggattcaccaagcaaagagcttcttacttgggctttggttaaagttgc |
40376124 |
T |
 |
| Q |
289 |
tcaacctggtgatcttgtagttgctctgcatgttcttgggactaatggtgagtgat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376125 |
tcaacctggtgatcttgtagttgctctgcatgttcttgggactaatggtgagtgat |
40376180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 379 - 513
Target Start/End: Original strand, 40376215 - 40376349
Alignment:
| Q |
379 |
atgatgattgatatgtgaaatgggtttgtgtagaaattgtgaatggagatgggaaatcatcgctgctttctcttgttaaggcttttgactctgttcttaa |
478 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376215 |
atgatgattgatatgtgaaatgggtttgtgtagaaattgtgaatggagatgggaaatcatcgttgctttctcttgttaaggcttttgactctgttcttaa |
40376314 |
T |
 |
| Q |
479 |
tgtttatgaaggattctgtaatttgaagcaggttc |
513 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40376315 |
tgtttatgaaggattctgtaatttgaagcaggttc |
40376349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 12 - 101
Target Start/End: Original strand, 40375845 - 40375934
Alignment:
| Q |
12 |
gtagcatagggtggtagcttcaaaaccaaaccttagttcatgacacaaacctttgtgttctgtacgctatatcacacaacctagttcact |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40375845 |
gtagcatagggtggtagcttcaaaaccaaaccttagttcatgacacaaacctttgtgttgtgtacgctatatcacacaacctagttcact |
40375934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 512
Target Start/End: Original strand, 10257777 - 10257882
Alignment:
| Q |
407 |
tgtagaaattgtgaatggagatgggaaatcatcgctgctttctcttgttaaggcttttgactctgttcttaatgtttatgaaggattctgtaatttgaag |
506 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || | |||||||||| || || ||||| || || ||| || ||| ||||||||||| || ||||| |
|
|
| T |
10257777 |
tgtagaaattgtgaatcgagatgggaaatcttctttattttctcttgtcaaagcatttgattcagtgctttctggttacgaaggattctgcaacttgaaa |
10257876 |
T |
 |
| Q |
507 |
caggtt |
512 |
Q |
| |
|
|||||| |
|
|
| T |
10257877 |
caggtt |
10257882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 273 - 325
Target Start/End: Original strand, 10257616 - 10257668
Alignment:
| Q |
273 |
ctttggttaaagttgctcaacctggtgatcttgtagttgctctgcatgttctt |
325 |
Q |
| |
|
||||||| || ||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
10257616 |
ctttggtcaatgttgctcaacctggtgatcttattcttgctcttcatgttctt |
10257668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University