View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_28 (Length: 372)
Name: NF15978_high_28
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 106 - 241
Target Start/End: Complemental strand, 42717611 - 42717476
Alignment:
| Q |
106 |
aatgcaattcacactactatctttccccttcgttcttttcttttttcattcacacttgctagatctgacttcaattaactcatttcgtactattattctt |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42717611 |
aatgctattcacactactatctttccccttcgttcttttcttttttcattcacacttgctagatctgacttcaatcaactcattttgtactattattctt |
42717512 |
T |
|
| Q |
206 |
ttttctttcttcgtctctatattattgatattactt |
241 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42717511 |
ttttctttcttcgtctcgttattattaatattactt |
42717476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 317 - 364
Target Start/End: Complemental strand, 42717414 - 42717367
Alignment:
| Q |
317 |
ggatgatgggatatgatctagttgcatatttggatggatttgatgatg |
364 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717414 |
ggatgatggaatatgatctagttgcatatttggatggatttgatgatg |
42717367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University