View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_37 (Length: 347)
Name: NF15978_high_37
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 53660472 - 53660244
Alignment:
| Q |
1 |
acttctaaatttttaaatgtataacctacaggtttggatgaggaagtttaagacgaacctagacaagttggaatgagaatgacggcttttatgctgaaaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660472 |
acttctaaattttaaaatgtataacctacaggtttggatgaggaagtttaagacgaacctagactagttggaatgagaatgacggcttttatgctgaaaa |
53660373 |
T |
 |
| Q |
101 |
ttgaataattggaactgaatatctattaaagctaacatgaattttagnnnnnnncgttgcttatacgctttgcaaatagataataacaattttgttccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660372 |
ttgaataattggaactgaatatctattaaagctaacatgaattttagtttttttcgttgcttatacgctttgcaaatagataataacaattttgttccct |
53660273 |
T |
 |
| Q |
201 |
attttataaacctcaccatctctcttgtt |
229 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
53660272 |
attttataaacctcaccctctctcttgtt |
53660244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 226 - 330
Target Start/End: Complemental strand, 53660208 - 53660104
Alignment:
| Q |
226 |
tgttcgtcctaacgaaataagtatctcactgannnnnnngtgacataggtcacattgaccaaatcgcgtaaacttttgtgtcttgttctttcctcttttt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53660208 |
tgttcgtcctaacgaaataagtatctcactgatttctttgtgacgtaggtcacattgaccaaatcgcgtaaacttttgtgtcttgttctttcctcttttt |
53660109 |
T |
 |
| Q |
326 |
ccttt |
330 |
Q |
| |
|
||||| |
|
|
| T |
53660108 |
ccttt |
53660104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University