View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_43 (Length: 321)
Name: NF15978_high_43
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 20 - 295
Target Start/End: Original strand, 48332208 - 48332484
Alignment:
| Q |
20 |
cgagacagagttgtttccagaattccataccgatctggttcccgcattgtccaacctgaagtgtgattatctctcgaggcattttttagggtttcggagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48332208 |
cgagacagagttgtttccagaattccataccgatctggttcccgcattgtccaacctgaagtgtgattatctctcgaggcattttttagggtttcggagg |
48332307 |
T |
 |
| Q |
120 |
gaacaacctttttgaaatgaattaaacaagtaaatagaaatggatcaagtaactgaaacgcnnnnnnnctttgtttagtagtggatgcttaactaaca-- |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48332308 |
gaacaacctttttgaaatgaattaaacaagtaaattgaaatggatcaagtaactgaaacgctttttttctttgtttagtagtggatgcttaactaacact |
48332407 |
T |
 |
| Q |
218 |
----ctcactctcactctcactcggtaatcattcatcgccacccctctctcctctacttttcaaccgccatattgcactctg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||| |
|
|
| T |
48332408 |
cactctcactctcactctcactcggtaatcattcatcgccaccact-----ctctacttttcaaccgccaaattgcactctg |
48332484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University