View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_54 (Length: 273)
Name: NF15978_high_54
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 33948176 - 33947934
Alignment:
| Q |
19 |
tgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcggttggaatgtgaaggggtgattatatagagaagggaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948176 |
tgtttgtggaaccaaattccaaaccaaacagttgctatggtggaaatggaaaatgggtgtcggttggaatgtgaaggggtgattatatagagaagggaag |
33948077 |
T |
 |
| Q |
119 |
tggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggactagactggtttttagaaggagcagcctttactagacta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948076 |
tggggaaggatagaggaaagaggggggtatgagtgggaaagattgacttttgagtgaaggactagactggtttttagaaggagcagcctttactagacta |
33947977 |
T |
 |
| Q |
219 |
ccaattgttttccttgctatcattaattatagtatattcttgg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33947976 |
ccaattgttttccttgctatcattaattatagtattttcttgg |
33947934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University