View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_57 (Length: 270)
Name: NF15978_high_57
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 30798923 - 30798680
Alignment:
| Q |
18 |
ccaggcatcatgaagaatgcagaacgagaaatgctccctggttcatgcgccatgcacatgttgttcatagataattaacaattgttaattttctgcccca |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
30798923 |
ccaggcatcatgtagaatgcagaacgagaaatgctccctggttcatgcgccatgcacatgttgttcatagataa---acatttgttaattttctgcccca |
30798827 |
T |
 |
| Q |
118 |
taccttgcacatgctgagtgcagatttttgcctataaagcctgttttgatccataaatattcatttagagcatcaacaaggggtgttttcctacctcctt |
217 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30798826 |
taacttgcacatgctgagtgcagatttttgcctataaagcctgttttgatccacaaatattcatttagagcatcaacaaggggtgttttccaacctcctt |
30798727 |
T |
 |
| Q |
218 |
ccacttgttcttatgcatgtttacttttattttctctttgatgatgt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30798726 |
ccacttgttcttatgcatgtttacttttattttctctttgatgatgt |
30798680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University