View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_65 (Length: 260)
Name: NF15978_high_65
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 110 - 232
Target Start/End: Complemental strand, 29007789 - 29007667
Alignment:
| Q |
110 |
gtattggactccctcgcggttaaggattttctgcattcacgtagtagacacattcaaagtcattctatcaagtcggacaattcaatttcatactcgatat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007789 |
gtattggactccctcgcggttaaggattttctgcattcatgtggtagacacattcaaagtcattctatcaagtcggacaattcaatttcatactcgatat |
29007690 |
T |
|
| Q |
210 |
tataaagtctaaaataaaaatta |
232 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
29007689 |
tataaactctaaaataaaaatta |
29007667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 29007912 - 29007824
Alignment:
| Q |
1 |
tgaacaaaatgggaggagtttcaagtttggttaaataatgctatgataagtaactatatgtact--atatatattgtgtaccaatgctc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29007912 |
tgaacaaaatgggaggagtttcaagtttggttaaataatgctatgataagtaattatatgtactaaatatatattgtgtaccaatgctc |
29007824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 13150075 - 13150163
Alignment:
| Q |
1 |
tgaacaaaatgggaggagtttcaagtttggttaaataatgctatgataagtaactatatgtact--atatatattgtgtaccaatgctc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13150075 |
tgaacaaaatgggaggagtttcaagtttggttaaataatgctatgataagttactatatgtactaaatatatattgtgtaccaatgctc |
13150163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University