View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_high_71 (Length: 243)

Name: NF15978_high_71
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_high_71
NF15978_high_71
[»] chr5 (1 HSPs)
chr5 (76-228)||(15866266-15866418)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 15866266 - 15866418
Alignment:
76 tctgaacaattgtgaccagccaaatatttttgtatctgaacccatggctttaagggttcttttccttttacgtattattgaacccatggctttagagggt 175  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
15866266 tctgaacaattgtgaccagccaaatatttttgtatctgaacccatggctttaagggttcttttccttttaggtattattgaacccatggctttagagggt 15866365  T
176 tcgtttcgttttaggcattattgcaaagttgatctagatgaatggtagagtct 228  Q
    ||||||| |||||||||||||||||||||||||||||| ||||||||||||||    
15866366 tcgtttccttttaggcattattgcaaagttgatctagaggaatggtagagtct 15866418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University