View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_72 (Length: 243)
Name: NF15978_high_72
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 32164674 - 32164610
Alignment:
| Q |
170 |
tttcatccagtcgccatgaggacgacatcatccaatttcaccgataaaattgatatcatctgtga |
234 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
32164674 |
tttcatccagtcgccatgaggacgacgtcatccaatttcaccaataaaattgatgtcatctgtga |
32164610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 36 - 89
Target Start/End: Complemental strand, 32164753 - 32164700
Alignment:
| Q |
36 |
ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcatgtgat |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32164753 |
ttatgcaatgatgacgacaaattttgttctcatattaagtgagaatcacgtgat |
32164700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 14729588 - 14729624
Alignment:
| Q |
1 |
tcttttagtctttaaatctacgattcttgtctatgtt |
37 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
14729588 |
tcttttagtctttaaatctatgatccttgtctatgtt |
14729624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University