View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_79 (Length: 236)
Name: NF15978_high_79
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 34686465 - 34686666
Alignment:
| Q |
18 |
gatgttatatccctcagattcttttttcattgtcgttttaaagttcaatgcaacatttagtatgtatgaaacaacattttataaataccaaaacaagcaa |
117 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
34686465 |
gatgttatatccctct-attcttttttaattgtcgttttaaagttcaatgcaacatt-agtatgtatgaaacaacatttcataaataccaaaacaaccaa |
34686562 |
T |
|
| Q |
118 |
tatatttgttttatggagtatagtatagtatttaacttattatatatgcattcagagaccaaaatgactatca--catagtatagtatatatctaactta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
34686563 |
tatatttgttttatggagtatagtatagtatttaacttattatatatgcattcagagaccaaaatgaccatcactcatagtata----atatctaactta |
34686658 |
T |
|
| Q |
216 |
ccctatgc |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
34686659 |
ccctatgc |
34686666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University