View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_82 (Length: 227)
Name: NF15978_high_82
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_82 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 39478296 - 39478075
Alignment:
| Q |
6 |
aatatctggcactatcttatgagattatgataaatatacaagggaatagttgatccccttgtcaattggtttaaggtttgtaaactgttttttgatttca |
105 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39478296 |
aatatctggcactatcttatgagactatgataaatatacaagggaatagttgatccccttgtcaattggtttacggtttgtaaactgttttttgatttca |
39478197 |
T |
 |
| Q |
106 |
tcatgcatgcttctttgtttatctacattattcatttaatttagttgaactctgagatattttgcttaaaagaaatgaaaatggaaattagaatgagcaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39478196 |
tcatgcatgcttctttgtttatctacattattcatttaatttagttgaactctgagatattttgcttaaaagaaatgaaaatgaaaattagaatgagcaa |
39478097 |
T |
 |
| Q |
206 |
tatccctaggagaaatgatatt |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39478096 |
tatccctaggagaaatgatatt |
39478075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University