View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_86 (Length: 222)
Name: NF15978_high_86
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_86 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 51848504 - 51848725
Alignment:
| Q |
1 |
tttttctaatccgcactctatccgtgatgcaattcctatttcagccaccgaaatcgaaaaccctactctctatgattcaacttcttcttcaacttcgtca |
100 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51848504 |
tttttctaatccacactctatccatgatgcaattcctatttcaaccaccgaaatcgaaaaccctactctctatgattccacttcttcttcaacttcgtca |
51848603 |
T |
 |
| Q |
101 |
tcatcgacaaccgatgaagattcacatcgcttcaagtctccgaaatctaaaaccaagtacgaggatgaacatgctcgattgctttccgcatcactcgttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51848604 |
tcatcgacaaccgatgaagattcacatcgcttcgagtctccgaaatctaaaaccaagtacgaggatgaacatgctcgattgctttccgcatcactcgttc |
51848703 |
T |
 |
| Q |
201 |
acgtcgttcgtacactcactct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51848704 |
acgtcgttcgtacactcactct |
51848725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University