View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_88 (Length: 219)
Name: NF15978_high_88
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_88 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 12125416 - 12125228
Alignment:
| Q |
15 |
caaaggggcatgacacttggtgtagagacgcatccagtggggccaagaagggcgatccaggaaggtacaactggtggagaaaggacgcaaaccttaaagc |
114 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
12125416 |
caaagaggcatgacccttggtgtagagacgcatccagcggggccaagaagggcgacccaggaaggtacaactggtggagaaaggacacaacccttaaagc |
12125317 |
T |
 |
| Q |
115 |
caaacaacatcagttctgtctgcggttaccaataggaacagtcacaaccattatgattaattgtatctattaagagcgggcgataattg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
12125316 |
caaacaacatcagttctgtctgcggttaccaataggaaaagtcacaaccattatgattaattgtatctcttaagaacgagcgataattg |
12125228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 4416533 - 4416360
Alignment:
| Q |
16 |
aaaggggcatgacacttggtgtagagacgcatccagtggggccaagaagggcgatccaggaaggtacaactggtggagaaaggacgcaaaccttaaagcc |
115 |
Q |
| |
|
|||| ||| |||| |||||||||||||| |||||||||||||||||| |||| | ||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4416533 |
aaagaggcgtgacccttggtgtagagacacatccagtggggccaagaggggcaacccaggaaggtacagctggtggagaaaggacgcaacccttaaagcc |
4416434 |
T |
 |
| Q |
116 |
aaacaacatcagttctgtctgcggttaccaataggaacagtcacaaccattatgattaattgtatctattaaga |
189 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4416433 |
aaacaatatcagttctgtcagcggttaccaataggaatagtcacaaccattatgattaattgtatctattaaga |
4416360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University