View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_89 (Length: 217)
Name: NF15978_high_89
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_89 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 36 - 202
Target Start/End: Complemental strand, 6330665 - 6330499
Alignment:
| Q |
36 |
tggaataatttgcaagtttatatcaaacatggaaaatgtcgcaattaaatctaacttggtccaacctactattggcacccatatagaacccccaaccaat |
135 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
6330665 |
tggaataatttgtaagtttatatcaaacatggaaaatgtcgcaattaaatctaacttggtccaacctactattgccacccatatagaagccccaaccaat |
6330566 |
T |
 |
| Q |
136 |
gcatgttaatgggattcccacgtaacccaccatatagtatataaatgtgagcctatagagtaataag |
202 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
6330565 |
gcatgttaatgggattgcaacgtaacccaccatatagtatataaaagtgagtctatagagtaataag |
6330499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University