View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_high_94 (Length: 204)
Name: NF15978_high_94
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_high_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 31519868 - 31519698
Alignment:
| Q |
16 |
aaaatcatttcctcgccaatgcttcaccatctcagacaccttcgtcagcgtggctatgcaccacccatgcagcaggttcgggagctcttttagctcccgt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
31519868 |
aaaatcatttcctcgccaatgctccaccgtctcagacacgttcatcagcgtggctatgcaccacccatgcagcaggttcgggagtttttttagctcccac |
31519769 |
T |
 |
| Q |
116 |
ggctgtgtttgatggcagtgttcgtcgccatagttctaaatttggtggattcaacagtggtgattgtagtg |
186 |
Q |
| |
|
|||| ||||||||| |||| || ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31519768 |
agctgcgtttgatggtagtgctcctcgccatagttctaaatttggtggattcaacggtggtgattgtagtg |
31519698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University