View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_19 (Length: 428)
Name: NF15978_low_19
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 44798219 - 44798462
Alignment:
| Q |
18 |
actaacgctactacaaacaaatttaaaacta---cactgactttatttcagtttaacccctcaatggtcctatgtgaagaatcataactagaaatgtaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
44798219 |
actaacgctactacaaacaaatttaaaactactacactgactttatttcagtttaacccctcaatggtcctatgtgaagaatcctaactaaaaatgtaat |
44798318 |
T |
|
| Q |
115 |
gttttgtttgaatttagaagacacaacaattcaagattaggccaagaaacagattgagtatgtgtatcactctctctccttcatctttaccatgaaaaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798319 |
gttttgtttgaatttagaagacacaacaattcaagattagaacaagaaacagattgagtatgtgtatcactctctctccttcatctttaccatgaaaaca |
44798418 |
T |
|
| Q |
215 |
aattcttgaaaacttcatcactcttaattctacacaatgctcag |
258 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44798419 |
aattcttgaaaacttcaccactcttaattctacacaatgctcag |
44798462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 329 - 402
Target Start/End: Original strand, 44798533 - 44798606
Alignment:
| Q |
329 |
caaaacatcacactctttggtgatgcttcctacacagacactgccattactctcacaaaacaacaacactcttg |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
44798533 |
caaaacatcacactctttggtgatgcttcctacacagacacttccattactctcacaaaacaacaacacacttg |
44798606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University