View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_49 (Length: 310)
Name: NF15978_low_49
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 10 - 196
Target Start/End: Original strand, 39747364 - 39747554
Alignment:
| Q |
10 |
aactcaacttaaaaggataagaatttaaaggttttaaatttacattctgatnnnnnnnnnttaatttaacaattaactattaacattctatcattatcat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39747364 |
aactcaacttaaaaggataagaatttaaaggttttaaatttacattctgataaaaaaaa-ttaatttaacaattaactattaacattctatcattaccat |
39747462 |
T |
 |
| Q |
110 |
attttatcatctatagttgtatagatgaacaatatcatataccatatgtcaaataaaatttggagaattatt-----gaataactttttgtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39747463 |
attttatcatctatagttgtatagatgaacaatatcatataccatatgtcaaataaaatttggagaattattcatgtgaataactttttgtt |
39747554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University