View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_54 (Length: 282)
Name: NF15978_low_54
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_54 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 31 - 282
Target Start/End: Complemental strand, 31200321 - 31200065
Alignment:
| Q |
31 |
tggtccatcgtaatcgagataaataaagatttagtttat---atgcaccgaaaatgtaannnnnnnnnngttgtttaaacacacgtacaatcaaatcact |
127 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
31200321 |
tggtccatcataatcgagataaataaagatttagtttattatatgcaccgaaaatgtaatatttttttt-ttgtttaaacacgcgtacaatcaaatcact |
31200223 |
T |
 |
| Q |
128 |
ttata---ccgtttttataggatggagttgctagttgtactccatgcttgattaagcttcagtcttttcttatagttgtatttcgaccattttgttatcc |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31200222 |
ttatagtgccgtttttataggatggagttgctagttgtactccatgcttgattaagcttcagtcttttcttatagttgtatttcgaccattttgttatcc |
31200123 |
T |
 |
| Q |
225 |
ataaaagaaagttaaactcaaaagtttcatttctctcatcataatggaatcattttca |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31200122 |
ataaaagaaagttaaactcaaaagtttcatttctctcatcataatggaatcattttca |
31200065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 15214036 - 15214002
Alignment:
| Q |
1 |
catgtttgggactctttttgtttattatgttggtc |
35 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15214036 |
catgtttgggactctttttgtttgttatgttggtc |
15214002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University