View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_55 (Length: 276)
Name: NF15978_low_55
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 114 - 254
Target Start/End: Complemental strand, 31874951 - 31874810
Alignment:
| Q |
114 |
tatacatcaatagtttaaatgaaggatttacaaaatattagtgatggggtgggattgagtagagggaggtggtttgatatgtatatgttgcaggcagtga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31874951 |
tatacatcaatagtttaaatgaaggatttacaaaatattagtgatggggtgggattgagtagagggaggtggtttgatatgtatatgttccaggcagtga |
31874852 |
T |
 |
| Q |
214 |
ggaataatggagaacataa-tctttttggcggtatccttagt |
254 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
31874851 |
ggaataacggagaacataattctttttggcggtatccttagt |
31874810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 31875102 - 31875055
Alignment:
| Q |
34 |
caagaaattaataaaaatatctagagattaatgagttacataaaacat |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
31875102 |
caagaaactaataaaaatatctagagattaaagagttagataaaacat |
31875055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 101
Target Start/End: Complemental strand, 31874995 - 31874967
Alignment:
| Q |
73 |
ataaaacatggttattgttattgtatcgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31874995 |
ataaaacatggttattgttattgtatcgt |
31874967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University