View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_63 (Length: 265)
Name: NF15978_low_63
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_63 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 7600171 - 7600346
Alignment:
| Q |
19 |
tgtataactctcaaatcaatatgcctaatgctaactgtgaataagcaaatatttgagaagcaaatgagccgctcattaaatgtagtttatagtttttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600171 |
tgtataactctcaaatcaatatgcctaatgctaactgtgaataagcaaatatttgagaagcaaatgagccgctcattaaatgtagtttatagtttttcat |
7600270 |
T |
|
| Q |
119 |
taattaagcaagtgtatcatttatagnnnnnnnncttccttaatgtatgtgaattaagcaagtgagccactcttcctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600271 |
taattaagcaagtgtatcatttatagttttttt--ttccttaatgtatgtgaattaagcaagtgagccactcttcctt |
7600346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 265
Target Start/End: Original strand, 31935554 - 31935603
Alignment:
| Q |
216 |
gtgaaaaggtttgcttttagttttctcgagggaaaagttttatttacctt |
265 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
31935554 |
gtgaaaagttttgcttttagttttcttgagcgaaaagttttatttacctt |
31935603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University