View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_64 (Length: 264)
Name: NF15978_low_64
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 41604922 - 41605162
Alignment:
| Q |
17 |
atatttttcatgtgagaatctacaatctcctcaactttacctctccaacttttccttgccctcctatgaccactttgccctttctccttcgacgatttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41604922 |
atatttttcatgtgagaatctacaatctcctcaactttacctctccaacttttccttgccctcctatgaccactttgccctttctccttcgacgatttca |
41605021 |
T |
 |
| Q |
117 |
tagtgtgtgcaatagttgagagatcctcatcgttattttcagatgaggatgtctcaaattcagacgagttcgagaaacttaggctttgtgagtacttgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41605022 |
tagtgtgtgcaatagttgagagatcctcatcgttattttcagatgaggatgtctcaaattcagacgagttcgagaaacttaggctttgtgagtacttgtg |
41605121 |
T |
 |
| Q |
217 |
gttatggatcaaattgtgatcaacaccattagtattttctt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41605122 |
gttatggatcaaattgtgatcaacaccattagtattttctt |
41605162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University