View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_65 (Length: 264)
Name: NF15978_low_65
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 41 - 225
Target Start/End: Original strand, 23051586 - 23051770
Alignment:
| Q |
41 |
gcaacaacaatggtgtctggttacttgggttgtcattaatgatgtatgttttctatgcataatcatttcgaattcttgtgcacaaaatctctatttatac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23051586 |
gcaacaacaatggtgtctggttacttgggttgtcattaatgatgcatgttttctatgcataattatttcgaattcttgtgcacaaaatctctatttatac |
23051685 |
T |
|
| Q |
141 |
ataacctcacccatttcacacactactcacaatcatctttcagtttcagttgtcaaacctccgttgaaaaactcttttcatcctt |
225 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
23051686 |
atcccctcacccatttcacacactactcacaatcatctttcagtttcggttgtcaaacctcatccgaaaaactcttttcatcctt |
23051770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University