View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_73 (Length: 243)
Name: NF15978_low_73
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 15866266 - 15866418
Alignment:
| Q |
76 |
tctgaacaattgtgaccagccaaatatttttgtatctgaacccatggctttaagggttcttttccttttacgtattattgaacccatggctttagagggt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15866266 |
tctgaacaattgtgaccagccaaatatttttgtatctgaacccatggctttaagggttcttttccttttaggtattattgaacccatggctttagagggt |
15866365 |
T |
 |
| Q |
176 |
tcgtttcgttttaggcattattgcaaagttgatctagatgaatggtagagtct |
228 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15866366 |
tcgtttccttttaggcattattgcaaagttgatctagaggaatggtagagtct |
15866418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University