View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_79 (Length: 239)
Name: NF15978_low_79
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_79 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 22 - 231
Target Start/End: Original strand, 7841160 - 7841368
Alignment:
| Q |
22 |
ctctttctaatataagaaagataacaagttaagcatgttaagaaagggtatcaacagctcaactaattcattttacactatataactacaaaatgttatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7841160 |
ctctttctaatataagaaagataacaagctaagcatgttaagaaagggtatcaacagctcaactaattcattttacaatatataactacaaaatgttatg |
7841259 |
T |
 |
| Q |
122 |
cattacttaggtttgtgataatgcaaaatccctataacattaaaagggacatgttatatctatatgaaacaagtgcagtcataacatggagttaagcatg |
221 |
Q |
| |
|
|| | | |||||||| ||||||||||||||||||| |||||||| |||||||||||||||||| | |||||||||||||||||||||||| |||| |||| |
|
|
| T |
7841260 |
ca-tgcataggtttgggataatgcaaaatccctatgacattaaatgggacatgttatatctatctaaaacaagtgcagtcataacatggatttaaacatg |
7841358 |
T |
 |
| Q |
222 |
tttagattca |
231 |
Q |
| |
|
||| |||||| |
|
|
| T |
7841359 |
tttggattca |
7841368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University