View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_80 (Length: 236)
Name: NF15978_low_80
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 38946435 - 38946224
Alignment:
| Q |
20 |
ctgctttcggttctgttcataaaactcgttgcatcacgtcatctcattaacaacccatcatatgttaatttacatttttcatttgttattgtttcttatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38946435 |
ctgctttcggttctgttcataaaactcgttgcatcacgtcatctcattaacaacccatcatatgttaatttacatttttcatttgttattgtttcttatg |
38946336 |
T |
 |
| Q |
120 |
tcattattaaaaacacatattcatgttcttnnnnnnnnnnnncacatattcatgtgttaannnnnnnatcagccaaacccatttttatagctttattaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
38946335 |
tcattattaaaaacacatattcatgttctt--aaaaaaaaaacacatattcatgtgttaa-ttttttatcagccaaacccatttttatagctttatt-aa |
38946240 |
T |
 |
| Q |
220 |
aaactagtgcatcact |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38946239 |
aaactagtgcatcact |
38946224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 50 - 123
Target Start/End: Complemental strand, 16633948 - 16633875
Alignment:
| Q |
50 |
gcatcacgtcatctcattaacaacccatcatatgttaatttacatttttcatttgttattgtttcttatgtcat |
123 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16633948 |
gcatcacatcatctcattaacaacccatcatatgataatttacatttttcatgtgttattgtttcttatgtcat |
16633875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 16633798 - 16633750
Alignment:
| Q |
187 |
atcagccaaacccatttttatagctttattaaaaaactagtgcatcact |
235 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
16633798 |
atcagccaaacccatttttatgtctttattaaaaaacaagtgcatcact |
16633750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University