View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_88 (Length: 222)
Name: NF15978_low_88
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_88 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 34 - 187
Target Start/End: Original strand, 32702607 - 32702763
Alignment:
| Q |
34 |
gggcagcatgtgatcggttgcatttttgttaaagcggttaaaaacctcctcagtgacaccttcaccaaaatgactaac---aaacaaaggttcagccaca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32702607 |
gggcagcatgtgatcggttgcatttttgttaaagcggttaaaaacctcctcagtgacaccttcaccaaaatgactaaccaacaacaaaggttcagccaca |
32702706 |
T |
 |
| Q |
131 |
gcccttatgcattgtgccacatcgtatccattatcaagttcattcaaatttacttca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702707 |
gcccttatgcattgtgccacatcgtatccattatcaagttcattcaaatttacttca |
32702763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 89 - 161
Target Start/End: Original strand, 32626882 - 32626954
Alignment:
| Q |
89 |
acaccttcaccaaaatgactaacaaacaaaggttcagccacagcccttatgcattgtgccacatcgtatccat |
161 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||| ||| || |||||||||||||||| |||||||| |
|
|
| T |
32626882 |
acaccttcaccaaaatgactgactagcaaaggttcagccaaagctctcatgcattgtgccacattgtatccat |
32626954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 57 - 161
Target Start/End: Original strand, 5810555 - 5810659
Alignment:
| Q |
57 |
ttttgttaaagcggttaaaaacctcctcagtgacaccttcaccaaaatgactaacaaacaaaggttcagccacagcccttatgcattgtgccacatcgta |
156 |
Q |
| |
|
|||| ||| |||| ||||||| ||| | | |||||||||||||||| |||||| | | |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5810555 |
ttttcttatagcgattaaaaatctctttaatgacaccttcaccaaagtgactagctagcaaaggttcagccacagcccttatgcattgtgccacattgta |
5810654 |
T |
 |
| Q |
157 |
tccat |
161 |
Q |
| |
|
||||| |
|
|
| T |
5810655 |
tccat |
5810659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 87 - 161
Target Start/End: Original strand, 27735885 - 27735959
Alignment:
| Q |
87 |
tgacaccttcaccaaaatgactaacaaacaaaggttcagccacagcccttatgcattgtgccacatcgtatccat |
161 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
27735885 |
tgacaccttcaccaaagtgactaactagcaaaggttcagccacagccctaatgcattgtgccatattgtatccat |
27735959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 124
Target Start/End: Original strand, 21941694 - 21941752
Alignment:
| Q |
66 |
agcggttaaaaacctcctcagtgacaccttcaccaaaatgactaacaaacaaaggttca |
124 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||| || |||||||||| |
|
|
| T |
21941694 |
agcggttaaatacctcttcagtcacaccttcaccaaaatgactaataagcaaaggttca |
21941752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University