View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15978_low_95 (Length: 206)
Name: NF15978_low_95
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15978_low_95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 8217856 - 8217684
Alignment:
| Q |
20 |
actagcgcaactatggtacctccaatataattgctgcaaaatgcaaagttcaaatttcagctactatgatgaacatggtttaaaggaagatcttgctatg |
119 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8217856 |
actagcgcacctgtggtacctccaatataattgctgcaaaatgcaaagttcaaatttcagctactatgatgaacatggtttaaaggaagatcttgctatg |
8217757 |
T |
 |
| Q |
120 |
tttagtaaatgttatgattataaaattcattttttgaactaaaaatggtaaggtatttttcaaatattcatat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8217756 |
tttagtaaatgttatgattataaaattcattttttgaaccaaaaatggtaaggtatttttcaaatattcatat |
8217684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University