View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15978_low_95 (Length: 206)

Name: NF15978_low_95
Description: NF15978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15978_low_95
NF15978_low_95
[»] chr1 (1 HSPs)
chr1 (20-192)||(8217684-8217856)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 8217856 - 8217684
Alignment:
20 actagcgcaactatggtacctccaatataattgctgcaaaatgcaaagttcaaatttcagctactatgatgaacatggtttaaaggaagatcttgctatg 119  Q
    ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8217856 actagcgcacctgtggtacctccaatataattgctgcaaaatgcaaagttcaaatttcagctactatgatgaacatggtttaaaggaagatcttgctatg 8217757  T
120 tttagtaaatgttatgattataaaattcattttttgaactaaaaatggtaaggtatttttcaaatattcatat 192  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
8217756 tttagtaaatgttatgattataaaattcattttttgaaccaaaaatggtaaggtatttttcaaatattcatat 8217684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University