View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15979_low_2 (Length: 223)
Name: NF15979_low_2
Description: NF15979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15979_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 903091 - 903302
Alignment:
| Q |
9 |
acatcatcaagggggcttaggtataaacctaaacataggcaatagtgaaaccttaatattgctctatatgtagtgtctttctcttgtc--------atac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
903091 |
acatcatcaagggggcttaggtataaacctaaacataggcaatagtgaaaccttaatattgctctatatgtagtgtctttctcttgtcattatgtcatac |
903190 |
T |
 |
| Q |
101 |
aaatgggacaaccctaccctactgtgtccgttaagagtgaaaaaaggccagaggaataagagatattctttgtccaaggtactaaatcactcaattactc |
200 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
903191 |
aaatggaacaaccctaccctagtgtgtccgttaagagtgaaaaaaggccagaggaataagagatattctttgtccaaggtactaaagcactcaattaccc |
903290 |
T |
 |
| Q |
201 |
aattcttctcag |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
903291 |
aattcttctcag |
903302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University