View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1597_low_2 (Length: 234)
Name: NF1597_low_2
Description: NF1597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1597_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 217
Target Start/End: Original strand, 38838135 - 38838349
Alignment:
| Q |
3 |
tctgtttgacattggctaagtagcgatagcgagcatgccaagaacaggtgataaatcaaactatcaccatcagccttaatccattcatgcatatcagaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838135 |
tctgtttgacattggctaagtagcgatagcgagcatgccaagaacaggtgagaaatcaaactatcaccatcagccttaatccattcatgcatatcagaag |
38838234 |
T |
 |
| Q |
103 |
tagacaaaaaataagtatgctgccaacaaattgttttgccattatgaggcagaatagcaacaatcccttctaaattatttaagcaaaattatttaacagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38838235 |
tagacaaaaaataagtatgctgccaacaaattgttttgccattatgaggcagaatagcaacaatcccttctaaattatttaagcaaaattatttaacagt |
38838334 |
T |
 |
| Q |
203 |
tgtgaattatttgcg |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38838335 |
tgtgaattatttgcg |
38838349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University