View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15980_high_3 (Length: 321)
Name: NF15980_high_3
Description: NF15980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15980_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 15 - 308
Target Start/End: Original strand, 43207119 - 43207413
Alignment:
| Q |
15 |
aggtttcacatgttacttagagttcacaaatggcaagaaccttaaaggccttcgcaacatctcaataactctcagcaatgtaatttaatt-attttatct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| || || ||||||||| |
|
|
| T |
43207119 |
aggtttcacatgttacttagagttcacaaatggcaagaaccttaaaggccttcgcaacatctcaataactctcagctcagcaatgtagtttattttatct |
43207218 |
T |
 |
| Q |
114 |
aggatgtaagctttaggtgcttcgcgacaatatgcgaaattaatgaataaatttctatccttagcgaactttgtttaaaattcctgttcagttcaggaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207219 |
aggatgtaagctttaggtgcttcgcgacaatatgcgaaattaatgaataaatttctatccttagcgaactttgtttaaaattcctgttcagttcaggaac |
43207318 |
T |
 |
| Q |
214 |
tgtacgaaaagctttagnnnnnnnatagtgctaattcgattcagtttagcagttcagttcagatttttggtgtttttgaatagccctagtttgat |
308 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207319 |
tgtacgaaaagcttcagtttttttatagtgctaattcgattcagtttagcagttcagttcagatttttggtgtttttgaatagccctagtttgat |
43207413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University