View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15981_high_8 (Length: 314)
Name: NF15981_high_8
Description: NF15981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15981_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 10 - 299
Target Start/End: Original strand, 1675004 - 1675293
Alignment:
| Q |
10 |
gcacagatcacattgaacagaagagagagttgcttgaggcaatactaaaaggtagacaattttccaaccttccaaagatcaaacaggtatatatataatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675004 |
gcacagatcacattgaacagaagagagagttgcttgaggcaatactaaaaggtagacaattttccaaccttccaaagatcaaacaggtatatatataatg |
1675103 |
T |
|
| Q |
110 |
tttatttatgtcctctcattatgtcttaaaaatatagcctttctttatttttaaattaaaactctagctttccaacctagtagatattgctcagttgtca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675104 |
tttatttatgtcctctcattatgtcttaaaaatatagcctttctttatttttaaattaaaactctagctttccaacctagtagatattgctcagttgtca |
1675203 |
T |
|
| Q |
210 |
ttgatgtcgctgttttcgattgtgtttggattttgggtttgaatgagcacaaacttatgtttgagtgaatctatttctccgggtgaattg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675204 |
ttgatgtcgctgttttcgattgtgtttggatttttggtttgaatgaggacaaacttatgtttgagtgaatctatttctccgggtgaattg |
1675293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University