View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15981_high_9 (Length: 270)
Name: NF15981_high_9
Description: NF15981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15981_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 33817372 - 33817118
Alignment:
| Q |
1 |
gcatatccagtcatgtagcctgtccgaacagttgcactctccggtttgcgagccgagcggtccgaccaaccaggtcggtccgggttttaaaacactggtt |
100 |
Q |
| |
|
|||||||| || |||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33817372 |
gcatatccgatcctgtagcctgtccgaacagctgcatcttccagtttgcgagccgagcggtccgaccaaccaggtcggtccgggttttaaaacattggtt |
33817273 |
T |
 |
| Q |
101 |
tttagattcttggtttgatgcgtagtggagtcnnnnnnnattttacacacattgcttatactttactcaatgcttccacatgttgaagtcttgaaaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817272 |
tttagattcttggtttgatgcgtagtggagtctttttttattttacacacattgcttatactttactcaatgcttccacatgttgaagtcttgaaaatat |
33817173 |
T |
 |
| Q |
201 |
aataattttttgttgttgaacataaaatattattgtaaataaattacagcctatg |
255 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817172 |
aataattttttgtcgttgaacataaaatattattgtaaataaattacagcctatg |
33817118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 8954051 - 8953966
Alignment:
| Q |
15 |
gtagcctgtccgaacagttgcactctccggtttgcgagccgagcggtccgaccaaccaggtcggtccgggttttaaaacactggtt |
100 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||| || ||| || |||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8954051 |
gtagcctgcccgaaccgttgcaccctccggttcgcaagctgaccggtccgaccggccgggtcggtccgggttttaaaacactggtt |
8953966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University