View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_high_21 (Length: 366)
Name: NF15982_high_21
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 74 - 355
Target Start/End: Original strand, 7499040 - 7499321
Alignment:
| Q |
74 |
gaaaggcatcaatgttggggccacattggaatccaatggcaacagaagtagcagtggtgttggaaggggaaggaatggtaagagtggtatgtggaagcaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499040 |
gaaaggcatcaatgttggggccacattggaatccaatggcaacagaagtagcagtggtgttggaaggggaaggaatggtaagagtggtatgtggaagcaa |
7499139 |
T |
 |
| Q |
174 |
caatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499140 |
caatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaat |
7499239 |
T |
 |
| Q |
274 |
cagacacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgc |
355 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499240 |
cagccacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgc |
7499321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University