View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_high_43 (Length: 271)
Name: NF15982_high_43
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 22757821 - 22758061
Alignment:
| Q |
18 |
gatacaagtactcatggtggcttttctgttcttcggaagcatgccacagaatgccttccatcactggtaataacaccatatttatggtttttaacagaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22757821 |
gatacaagtactcatggtggcttttctgttcttcggaagcatgccacagaatgccttccatcactggtaataacaccatctttatggtttttaacagaat |
22757920 |
T |
|
| Q |
118 |
tcgtgttaacaaatccaattttcttttgtgaaatttactaaaaccatgtcttgattttgtttaggatatgtcccagtctactccaactcaggaattggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22757921 |
tcgtgttaacaaatccaattttcttttgtgaaatttactaaaaccatgtcttgattttgtttaggatatgtcccagtctactccaactcaggaattggtt |
22758020 |
T |
|
| Q |
218 |
gctaaggatcttcacaattacgaatggcactttaagcatat |
258 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22758021 |
gctaaggatcttcataattacgaatggcactttaagcatat |
22758061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 76
Target Start/End: Complemental strand, 7076598 - 7076540
Alignment:
| Q |
18 |
gatacaagtactcatggtggcttttctgttcttcggaagcatgccacagaatgccttcc |
76 |
Q |
| |
|
||||| ||||| ||||||||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
7076598 |
gatactagtacacatggtggcttctctgttctcaggaaacatgccacagaatgccttcc |
7076540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University