View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_high_59 (Length: 236)
Name: NF15982_high_59
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_high_59 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 236
Target Start/End: Original strand, 7599927 - 7600153
Alignment:
| Q |
10 |
ataattcttgaagtgggtgctggccaacattccttgcaaaataaaaaaggtgttggccaacatagtaaaatctaaagtaaatgaatccatggttgttgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7599927 |
ataattcttgaagtgggtgctggccaacattccttgcaaaataaaaaaggtgttggccaacatagtaaaatctaaagtaaatgaatccatggttgttgaa |
7600026 |
T |
|
| Q |
110 |
ttaatgcattttcatggattttaagttgctaaatgctgtcatggtcccccatagctccaacttctcgtgatacctttaagacattgcgcatggtatcgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600027 |
ttaatgcattttcatggattttaagttgctaaatgctgtcatggtcccccatagctccaacttctcgtgatacctttaagacattgcgcatggtatcgaa |
7600126 |
T |
|
| Q |
210 |
tattatcagcaagagaagaacaattaa |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7600127 |
tattatcagcaagagaagaacaattaa |
7600153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University