View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_low_20 (Length: 377)
Name: NF15982_low_20
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 19 - 359
Target Start/End: Original strand, 7600130 - 7600470
Alignment:
| Q |
19 |
tatcagcaagagaagaacaattaatgaaaatatcattaaagctagttgtgtgaggtggctcaaaaggtgacattattattaatctaaaataatgagtatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600130 |
tatcagcaagagaagaacaattaatgaaaatatcattaaagctagttgtgtgaggtggctcaaaaggtgacattattattaatctaaaataatgagtata |
7600229 |
T |
 |
| Q |
119 |
taagtggccctccatgaggtcttccaaatgtgcttcagacctccttttagataagtctaaacaatatcctcaacaattatcatagcttcatcacagtgat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600230 |
taagtggccctccatgaggtcttccaaatgtgcttcaggcctccttttagataagtctaaacaatatcctcaacaattatcatagcttcatcacagtgat |
7600329 |
T |
 |
| Q |
219 |
tcttttctttagaccacatttgggggaggggatagagaattatttcattgcatataacttgtaataatttaaagtcacacccattgcatatattttcttt |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7600330 |
tcttttctttataccacatttgggggaggggatagagaattatttcattgcatataacttataataatttaaagtcacacccattgcatatattttcttt |
7600429 |
T |
 |
| Q |
319 |
taatctttgatccaacctgataaattattaatatagaatct |
359 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7600430 |
taatctttgatccaacctaataaattattaatatagaatct |
7600470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University