View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_low_30 (Length: 331)
Name: NF15982_low_30
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_low_30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 16 - 331
Target Start/End: Complemental strand, 24879904 - 24879589
Alignment:
| Q |
16 |
aatatgcaacaatattataaaaagtgcaaaaatatgaagagaatcttaaaatagtccatgcctcttcgaacttaaccaaaggtcttgggttagaattgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879904 |
aatatgcaacaatattataaaaagtgcaaaaatatgaagagaatcataaaatggttcgtgcctcttcgaacttaaccaaaggtcttgggttagaattgag |
24879805 |
T |
|
| Q |
116 |
ccctgatcagtagtccattgtagtcctacccgactcgagggttagtctttgcagtcttacccgattcgaaggattagtctttgcagttgcgtaaagagga |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| |
|
|
| T |
24879804 |
ccctgatcagcagtccattgtagtcctatccgactcgagggttagtctttgcagtcttacccgactcgaaggattagtcttcgcagttgcgtatagagga |
24879705 |
T |
|
| Q |
216 |
tacccgatttgcaccaaatatatgaagagaatcatttaagcatcccttggaaaatcaaaagggctccaattaccaattaacaagtctgcatcatgaattt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879704 |
tacccgatttgcaccaaatatatgaagagaatcatttaagcatcccttggaaaatcaaaagggctccaattaccaattaacaagtctgcatcatgaattt |
24879605 |
T |
|
| Q |
316 |
gatcaggaccaagaaa |
331 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24879604 |
gatcaggaccaagaaa |
24879589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 233
Target Start/End: Original strand, 40294727 - 40294779
Alignment:
| Q |
181 |
tcgaaggattagtctttgcagttgcgtaaagaggatacccgatttgcaccaaa |
233 |
Q |
| |
|
||||||||||||||| ||||||||| | | |||||||||||||| ||||||| |
|
|
| T |
40294727 |
tcgaaggattagtctccgcagttgcgcacaaaggatacccgatttacaccaaa |
40294779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University