View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_low_39 (Length: 286)
Name: NF15982_low_39
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 11 - 163
Target Start/End: Complemental strand, 47416648 - 47416496
Alignment:
| Q |
11 |
agaatatcataaaaaagggaaaatgacttgagaaatttttcaaagccttccaaaaccttaacagagtcctcccccaatttattttttgagttctctaaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47416648 |
agaatatcataaaaaagggaaaatgacttgagaaatttttcaaagccttccaaaaccttaacagagtcctcccccaatttattttttgagttctctaaaa |
47416549 |
T |
 |
| Q |
111 |
ttagggggtttcaatctttgtggaggaaaataaatccccatgggaagtgggga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47416548 |
ttagggggtttcaatctttgtggaggaaaataaatccccatgggaagtgggga |
47416496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 230 - 269
Target Start/End: Complemental strand, 47416429 - 47416390
Alignment:
| Q |
230 |
acaaacccttaagggatagctatagctataacctatagcc |
269 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47416429 |
acaaacccttaaggaatagctatagctataacctatagcc |
47416390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University